Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST134984
Clone ID OST134984
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST134984
Sequence
GAGACAATAAGAAGTTAGAAAAGGTGATGGAAGAAGAANGCCTGAACGACGAAGAGAAACCGACTCAGAAGATCCGCGCA
CGCTCGGAAGGAAACAGAGNTTCTTCGATTAAAGAGAACAAGGCTTGGACTGGAAGATTTTGAGTCTTTAAAAGTCATAG
GCCGAGGAGCATT
Sequence Type mRNA
Unitrap ID UNI19647

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29128250..29129415 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024006 (Stk38) NM_134115 serine/threonine kinase 38 Gene [Source:MGI (curated);Acc:Stk38-001]

 
Come back to gene ENSMUSG00000024006


For any suggestions or comments, please send an email to unitrap@crg.es