Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR055
Clone ID RRR055
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR055
Sequence
AGAAACCAGGTATCCCAAAATTCCCCTTTCCAATGAGCCCTCCCTTCAGAAACCATGGAGGAAATAGAGCACACATGCCC
ACAGCCTCGACTGACCCTGACTGCACCAGCCCCATTTGCTGATGAATCCAGCTGCCAGTGCCAAGCACCTCATGAAAAAC
TGACCGTTGCCCAGGCCCGCTTAGGAACACCAGTTGATAGGCCTGTTAGAGTGTATGCAGATGGAATATTTGACCTCTTC
CACTCAGGTCACGCAAGGGCACTTATGCAAGCAAAAACACTGTTTCCCAACAGCTACTTGTTGGTAGGAGTTTGCAGTGA
TGACCTTACTCACAAATTCAAAGGTTTTACTGTGATGAACGAGGCAGAGAGATATGAAGCTCTCAGACACTGTCGATACG
TGGATGAAGTCATCAGAGACGCGCCATGGACTCTTACTCCAGAGTTTCTGGAAAAACACAAGATTGACTTTGTGGCTCAC
GATGATATTCCATACTCCTCTGCTGGTTCTGATGACGTTTATAAGCATATCAAGGAAGCAGGCATGTTTGTTCCAACACA
AAGAACAGAAGGCATCTCAACATCAGACATCATCACCAGAATTGTCCGTGACTATGATGTATATGCCCGGCGTAATCTCC
AGAGAGGGTACACAGCCAAGGAGCTGAACGTCAGCTTTATAAAC
Sequence Type mRNA
Unitrap ID UNI7499

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 90920728..90977158 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035246 (Pcyt1b) NM_211138 phosphate cytidylyltransferase 1, choline, beta isoform Gene [Source:MGI (curated);Acc:Pcyt1b-003]

 
Come back to gene ENSMUSG00000035246


For any suggestions or comments, please send an email to unitrap@crg.es