Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR057
Clone ID RRR057
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR057
Sequence
CAGAGTAACCTGATGATGGAGAAGAGGAACAACTCGCTTCAAACATCCACTGAAAACACACAGGCAAGAATATTGCATGC
TGAACAAGAGAAGGCCAAGGTAACAGAAGAGTTAGCAGCAGCTACTGCACAGGTGTCTCACCTGCAGCTGAAAATGACGG
CTCACCAGAAGAAGGAGACAGAATTGCAGTTGCAGCTGACAGACAACTTGAAGGAGACAGATCTTCTCAGGGGCCACGTC
ACCAGGCTCCAGGCTGACCTCTCGGAGCTCCGAGAAGCCTCTGAGCAAACACAGACCAAATTCAAAAGTGAAAAGCAGAG
CCGGCGGCAGCTGGAGCTCAAGGTAACATCCCTGGAGGAAGAGCTGACTGACCTCCGAGCTGAGAAGACCTCCCTTGAAA
Sequence Type mRNA
Unitrap ID UNI7500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 61973294..61982085 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066151 (Fkbp15) FK506 binding protein 15 Gene [Source:MGI (curated);Acc:Fkbp15-003]

 
Come back to gene ENSMUSG00000066151


For any suggestions or comments, please send an email to unitrap@crg.es