Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST134784
Clone ID OST134784
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST134784
Sequence
GACTGAGCTGGGACAGAGAACCATGGTGCTGTATTTTGGCGAATACCAACACGTACAGCAGGAGTACGGGGTACACCTGA
GACTTGNCAGTGGTGACACTCCAAAGNCAANGANTTCCCAGCCCTCAAAGGCAGGCTCCTATGGTGTNAGCATCAGGGTC
CAGGGAATTGATTGGCCACCCTTATATAGTCCTGAATAACACTGAGCGGTGTCTAGCAGGCACACCTTTCCCAGAAAACG
CGCNATCGTTTCCATCTTCAGTGATAAATAACCTGTCCCTACATCCAAGCAACGGAACCGTGTTGAAGGAGAACACTCCG
GAGGAACTGCAGCTTCCAGAAAACCCGTACCTGCAAACCAGCCCGCTAAGAGGCCANAAGCAGTTCTCCCTCCACGAGGG
CAGGAATGGAGTTCTAGAACGCAAAGACGGGCCCACGAAGCTGCCCCATGTGCTCAACTTCCAGAGGCACCCGG
Sequence Type mRNA
Unitrap ID UNI13656

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71573424..71573891 447
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032232 (Cgnl1) NM_026599 cingulin-like 1 Gene [Source:MGI (curated);Acc:Cgnl1-003]

 
Come back to gene ENSMUSG00000032232


For any suggestions or comments, please send an email to unitrap@crg.es