Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST134731
Clone ID OST134731
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST134731
Sequence
CTTACCCACCAGAGGTGGTGGNTGCATCGNTGCTGCTTCCTGTGCATGGTTTGCAGGAAAAATTTAGACAGCACAACAGT
GGCGATTCATGATGAANTAGATCTACTGCAAATCCTGCTACGGAAAGAAGTATGGACCAAAAGGCTATGGTTATGGCCAG
GGCGCTGGCACGCTCAACATGGACCGCGGTGAGAGACTGGGCATCAAGCCAGAGAGTGCTCAACCTCACAGGCCTACGAC
AAATCCAAACACTTCTAAATTTGCCCAGAAATATGGAGGAGCTGAGAAGTGTTCCAGGTGTGGGGATTCCGTGTATGCTG
CGGAGAAGATCATTGGAGCTGGGAAGCCCTGGCACAAAAACTGTTTCCGGTGTGCCAAGTGTGGNAAGAGTCTGGAGTCT
ACAACTCTGACT
Sequence Type mRNA
Unitrap ID UNI10495

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110369091..110375758 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020186 (Csrp2) NM_007792 cysteine and glycine-rich protein 2 Gene [Source:MGI Symbol;Acc:MGI:1202907]

 
Come back to gene ENSMUSG00000020186


For any suggestions or comments, please send an email to unitrap@crg.es