Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST134693
Clone ID OST134693
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST134693
Sequence
CAGGTAATGTGAGGTGCAGGAGACAGGAAGCCAGCCAACGAGCTCACCTCCCACCATCAGC
Sequence Type mRNA
Unitrap ID UNI26143

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98178002..98178062 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046962 (Zfp295) NM_001081684 zinc finger protein 295 Gene [Source:MGI Symbol;Acc:MGI:1927240]

 
Come back to gene ENSMUSG00000046962


For any suggestions or comments, please send an email to unitrap@crg.es