Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CJ0151
Clone ID CJ0151
Vector pGT0lxrT2
Project sanger

Sequence tag CJ0151
Sequence
CTATCCACCACTGTTCTACTTTTTCATTTAATGCCTTTCGAACTTCTGATGGCATACCTGTAAAGGACTTGCAGTTGAAG
GAGTATAACACAGGTTACGACTATGGCTATGTCTGCGTGGAATTTTCACTCTTGGAAGATGCCATCGGATGCATGGAGGC
CAACCAG
Sequence Type mRNA
Unitrap ID UNI757

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107735765..107749664 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032582 (Rbm6) NM_029169 RNA binding motif protein 6 Gene [Source:MGI Symbol;Acc:MGI:1338037]

 
Come back to gene ENSMUSG00000032582


For any suggestions or comments, please send an email to unitrap@crg.es