Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR091
Clone ID RRR091
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR091
Sequence
AAAAAAAAAAAAACCATCTAGAAGAGCTCACAACCAGCTAGTATCGGCCTCAGGAAGATCGGATCTGGCTCTTTCGGGGA
CATTTATCTAGCGATCAACATCACCAATGGCGAGGAAGTGGCAGTGAAACTAGAATCCCAGAAGGCCAGGCATCCCCAGT
TGCTGTACGAGAGCAAACTGTATAAGATTCTTCAAGGTGGGGTTGGCATCCCTCACATACGGTGGTATGGGCAAGAAAAA
GACTATAATGTACTAGTCATGGATCTCCTGGGACCCAGCCTTGAAGACCTCTTCAACTTCTGTTCAAGGAGGTTCACTAT
GAAGACCGTACTTATGTTAGCTGACCAGATGATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACA
TTAAACCAGATAACTTCCTAATGGGTATTGGGCGTCACTGTAATA
Sequence Type mRNA
Unitrap ID UNI7512

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 61715466..61729214 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024576 (Csnk1a1) NM_146087 casein kinase 1, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1934950]

 
Come back to gene ENSMUSG00000024576


For any suggestions or comments, please send an email to unitrap@crg.es