Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST134445
Clone ID OST134445
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST134445
Sequence
GAAATGGGATACCCTGGCCCANAGANGTNAAGGGGAAACTCNGCCCCTGATGGTCCTAATGGTGGAATGCTTTCTTGCTT
ATGANTCCCCNGAGGTTTACTCAGNANTTTAAGGATGCAAACCCTGNNGGNTTCGGAAGAGCTTGAAANNAGAATTCNGA
TAGTGGCCGCAAGGANGATTCCCCCCACCTCCAAGTCGATCCACGCCTCGGCCAATCTGAGCCCGGATGCTAATTAGCTA
TGCTTCCTAGATGAACACGCCTTTGTCACATGTAGGGCCGGACTACAAGGCCCAGCATGCCTCTCCCCTCCCTGATCAAT
GAGGGCTTATTTAAATGATCTCTGAGGTCTTGGACCCAGGCCAATCAGCTGTCAGAGCTCATGATAAATCGCAATGCATT
ATTGATAAAAA
Sequence Type mRNA
Unitrap ID UNI19615

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168592648..168593287 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]

 
Come back to gene ENSMUSG00000027547


For any suggestions or comments, please send an email to unitrap@crg.es