Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR119
Clone ID RRR119
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR119
Sequence
AAGGCCAGAAATGTGAGCCGAACCTGCCTCCCTCCGGAGACAGCAGACAGATGCCCCAACAAGGGAGAAGCAATCTTCAT
GTAACATCTCAGGAAGATGCAGCATGCCGCAGGCCCAGGGAACGCCTTTCTAATGGTAACGCCAGGGCTCAGGTTTCCAA
G
Sequence Type mRNA
Unitrap ID UNI588

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20441498..20451689 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es