Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CJ0144
Clone ID CJ0144
Vector pGT0lxrT2
Project sanger

Sequence tag CJ0144
Sequence
CAGAGTGAGCAGCGGCTCCCGCCTGGCTCAGCAGACTGTGGCCACGGGTGTTGTGAACATCGACGAGGTGGACCCAGAGG
GCAGGTTCGTGCGCCTTAAGAACTCTTCAGACAAGGACCAGTCTTTGGGGAACTGGAGGATCAAGAGACAGGTTCTGGAG
GGTGAGGACATTGCCTACAAGTTCACACCCAAGTATGTTCTGCGGGCCGGCCAGACTGTCACGGTGTGGGCAGCTGGCGC
AGGGGCTACCCACAGTCCCCCATCAACCCTTGTGTGGAAAAGCCAGACCAACTGGGGCCCTGGGGAGAGCTTCCGCACTG
CCCTGGTCAGTGCCGACGGTGAGGAGGTGGCCGTGAAGGCTGCAAAGCACTCATCTGTCCAGGGGAGGGAGAACGGGGAA
GAGGAGGAAGAGGAAGAGGCAGAATTCGGTGAAGAGGACCTCTTCCACCAGCAG
Sequence Type mRNA
Unitrap ID UNI759

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80365957..80366974 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062075 (Lmnb2) NM_010722 lamin B2 Gene [Source:MGI Symbol;Acc:MGI:96796]

 
Come back to gene ENSMUSG00000062075


For any suggestions or comments, please send an email to unitrap@crg.es