Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST133958
Clone ID OST133958
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST133958
Sequence
GAACTGAGTACCCTTTCAATAGCCCCACTTCCAGGATGGAACCTTGTTTGATGAGCAGTACTCCCAGGCTGCATCCTACC
CCAGTGACTCCCCGATGGCCAGAGGTGCCGACTGCCAACGCATGCTACACAAGCCCATCTGTGCATTCCACGAGGTATGG
AAACTCTAGTGACATGTACACCCCGCTGACCACGCGCAGGAATTCTGAGTATGAGCACATGCAACACTTTCCTGGCTTTG
CTTACATCAACGGAGAGGCCTCCACTGGATGGGCTAAGTGACTGCTTTCATAGAAATCCATATTTAATATTAATAATTAA
TAATAATAATAAACCCAGTACCCACCCTC
Sequence Type mRNA
Unitrap ID UNI26154

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 84367698..84368040 343
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020037 (Rfx4) NM_027689 regulatory factor X, 4 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:1918387]

 
Come back to gene ENSMUSG00000020037


For any suggestions or comments, please send an email to unitrap@crg.es