Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST133615
Clone ID OST133615
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST133615
Sequence
AGAAAAGTGGAAAACCGCCATTACAGAATAATGAGGTAAAAGTTTTAAATGACCTACTTTTGGGGGTGGTTTGCATTATT
TAATCAATTTTGCTGGGTAAAACAATTTTAGAGTTAGAATACAAGTTTTAAAATCTCACTTCCATTTGACTACATACAAG
ACTCTGTCACAGGAATTCCCTTTTAAGAGTCTTGCCTAGAGTCTTCTGGTGCTGTTTGTTTGACAACGCTCCTCTAAGGA
GACAGTTATTAACTCGGTTAGGTTTAGCCCGAGATGACTTGCTGCCCATGTAGCTGTTTTTCTCCCTTCTATTGAGACAG
GATCTCACTGTATGTACCGTTCTAAGATGCTTAAACCCTCATCCTCCTGCCTCAGCCTCCTTAGTGCGGGGTTTAACGAG
NGTACCACTTTAATTAGAAGCTTTTTCTTTATATATTTATTATATCACA
Sequence Type mRNA
Unitrap ID UNI26159

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121498952..121499401 431
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028127 (Abcd3) NM_008991 ATP-binding cassette, sub-family D (ALD), member 3 Gene [Source:MGI Symbol;Acc:MGI:1349216]

 
Come back to gene ENSMUSG00000028127


For any suggestions or comments, please send an email to unitrap@crg.es