Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST133555
Clone ID OST133555
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST133555
Sequence
ACTGAGACCTTTGACATGGAGACGTCCAGCTCCATGTCTGTGGAGACGACTAGGTCTGTGCAGGTGGACGAATGGCAGAA
GAATTACTGTGTGGTTACATCCAGCATATGTACACCAAAGCAGAAGGCCGATGCATACCGTGCACTACTACTGCATATTC
AGTATGCATATGCCAACTCCGAGATCTCTCAGGTCTTTGCTACCAACCTGTTCAAAAGGTATACAGAAAAATACTCTGCA
ATTATTGATTCTGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI24678

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11702815..11703065 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035455 (Fignl1) NM_021891 fidgetin-like 1 Gene [Source:MGI (curated);Acc:Fignl1-001]

 
Come back to gene ENSMUSG00000035455


For any suggestions or comments, please send an email to unitrap@crg.es