Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR141
Clone ID RRR141
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR141
Sequence
GCTGGGGCCAGCAACAGCAGTGTGGGTGCAGGGGGCAACGGGGGAGGCGGCAGCAGTGGTGGTGGCAGTGGCGGCAGCAG
CGGCAGCGGAGCAGGCACCTACGTGATCCAAGGCGGCTACATGCTAGGCAATGCCAGCCAGTCTTACTCCCACACCACCC
GTGCCTCACCAGCCACA
Sequence Type mRNA
Unitrap ID UNI3166

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86611795..86611971 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031706 (Rfx1) NM_009055 regulatory factor X, 1 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:105982]

 
Come back to gene ENSMUSG00000031706


For any suggestions or comments, please send an email to unitrap@crg.es