Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST132439
Clone ID OST132439
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST132439
Sequence
TTAGTGCGATGGCTGTGACTTCCGAGCCCCATCTTACGAAGATCTCAAGGCACACATCCAGGATGTCCACACGGCTGTTC
TTACAGCCAACTGATGTTGCCGAGGACAATGATGACGAGCCACTATCTGGGTCCATGAATGCTAGTAATCAGACAGAGGG
AGTAATGTTATAATAATATTTTTATTAG
Sequence Type mRNA
Unitrap ID UNI2859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55020448..55020603 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]

 
Come back to gene ENSMUSG00000060206


For any suggestions or comments, please send an email to unitrap@crg.es