Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST132438
Clone ID OST132438
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST132438
Sequence
GACTGAGGCCTGACTACCAGAAACATGGCGACCAGCGCTGTTCCAAGTGAAAACCTTCCCACATATAAACTAGTAGTGGT
GGGAGATGGTGGTGTGGGCAAGAGTGCGCTCACTATTCAGTTTTTCCAGAAGATCTTTGTGCCTGACTACGACCCCACCA
TTGAAGACTCCTACCTGAAGCATACAGAGATTGACAATCAGTGGGCCATCTTGGATGTTCTGGACACAGCCGGGCAGGAG
GAGTTCAGTGCCATGCGGGAACAATACATGCGCACAGGGGATGGCTTCCTCATTGTCTACTCCGTCACCGACAAGGCCAG
CTTCGAGCACGTGGACCGCTTCCACCAGCTCATTCTGCGTGTCAAGGACAGGGAGTCATTCCCAATGATCCTCGTGGCCA
ACAAGGTGGATCTGATGCACCTAAGGAAAGTCACCAGGGACCAAGGAAAAGAAATGGCAACCAAATACAATATCCCATAT
ATAGAGACCAGTGCCAAGGACCCGCCTCTCAACGTGGATAAAACCTTCG
Sequence Type mRNA
Unitrap ID UNI12825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99290175..99312023 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032470 (Mras) NM_008624 muscle and microspikes RAS Gene [Source:MGI (curated);Acc:Mras-001]

 
Come back to gene ENSMUSG00000032470


For any suggestions or comments, please send an email to unitrap@crg.es