Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST132262
Clone ID OST132262
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST132262
Sequence
TGAGGCTGTGTGGAGATGGTGAAGCTGNTCATTGGAAATCTGCCCCGGNAGGCCACAGAGCATGAGATCCGCTCACTCTT
CGAGCAGTACCGGGAAGGTGCTGGAATGTGACATCATTAAGAATTATGGCTTTGTGCACATAGAGGACAAGACGGCCGCT
GAGGATGCCATACGCAACCTGCACCACTACAAGCTGCACCGGAGTGAACATCAATGTGGAAGCCAGCAAGAATAAGAGCA
AAGCTTCAACCAAGTTACACGTGGGCAACATCAGCCCCACTTGTACCAACCAAGAGCTTCGGGCCAAGTTTGAGGAGTAC
GGCCCAGTCATCGAATGTGACATCGTGAAAGATTATGCCTTTGTACACATGGAGCGGGCAGAGGATGCCGGTGGAGGCCA
TCAGGGGCCTCGACAACACAGAGTTTCAAGG
Sequence Type mRNA
Unitrap ID UNI19443

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4792397..4792822 411
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056951 (Rbm4) NM_009032 RNA binding motif protein 4 Gene [Source:MGI Symbol;Acc:MGI:1100865]

 
Come back to gene ENSMUSG00000056951


For any suggestions or comments, please send an email to unitrap@crg.es