Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST132082
Clone ID OST132082
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST132082
Sequence
GACTGAGGTGGGGTCTTTCCCAGGCACTTCAAANTAGTGCCTGGGATCCGGATGACAGCAGGCATTAAGGGCTGGCTACT
GGACTGAAGCTGCTGGAAACTTGGGAAGACCAGGTGTACACTCAAGACCTAGAATGACCAAGAATGTGGAACCTTAAAAA
AA
Sequence Type mRNA
Unitrap ID UNI26185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 160511223..160513592 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040749 (Siah1b) NM_009173 seven in absentia 1B Gene [Source:MGI (curated);Acc:Siah1b-002]

 
Come back to gene ENSMUSG00000040749


For any suggestions or comments, please send an email to unitrap@crg.es