Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST132046
Clone ID OST132046
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST132046
Sequence
TGAGGGTACTGGCTGTCACGCTGAAATGAACCCTCAGCAGTCCTCCGTCTACCATGGCTACCCTTAACTCAGCCTCTCCC
TCCGGAACCATTCCTTCCCCTGGGCACAATGTTCGGTCACCACCTCCAGAGACCTCCTCCT
Sequence Type mRNA
Unitrap ID UNI12168

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55693985..55694123 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040721 (Zfhx2) NM_001039198 zinc finger homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2686934]

 
Come back to gene ENSMUSG00000040721


For any suggestions or comments, please send an email to unitrap@crg.es