Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST132010
Clone ID OST132010
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST132010
Sequence
GACTGAGGATAAAAGGTCCCTCGCAAATATTTGAAAATGGCCACAAACAAAAGTGTTGGCGTGTTCAGCTCTGCATCCCT
GGCTGTGGAGTATGTGGACTCACTGTTGCCGGAGAATCCTCTGCAGGAGCCCTTTAAGAATGCTTGGGTCTACATGTTGG
ACAACTATACAAAGTTCCAGATCGCAACCTGGGGCTCCCTGATAGTTCACGAAGCCATCTATTTCTTGTTCTCTTTACCT
GGATTCCTATTCCAGTTTATACCTTACATGAGAAAGTACAAGATTCAAAAGGATAAACCAGAAACCTTCGAAGGCCAGTG
GAAGTGTTTGAAAAAAATTCTATTTAATCATTTTTTTATCCA
Sequence Type mRNA
Unitrap ID UNI26186

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 67202463..67206703 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031604 (Sc4mol) NM_025436 sterol-C4-methyl oxidase-like Gene [Source:MGI (curated);Acc:Sc4mol-001]

 
Come back to gene ENSMUSG00000031604


For any suggestions or comments, please send an email to unitrap@crg.es