Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST131669
Clone ID OST131669
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST131669
Sequence
AACTGAGTATTAACCGGGAGGGAACATCAATAGGCGTACAGAAACCTTCACAATGAAATCCGAAGCCAAGGATGGAGAGG
AGGAAAGTCTGCAAACTGCCTTCAAGAAATTAAGAGTGGACGCATCAGGGTCCATNATATCTCTGTCTGTTGGNNAAGGC
CCNAGNGTNAGAGCATCAGCCANANCAGCAGCCGATGATACCAAACCGAAAACCATGTGTGCATCTAAAGACAGTTGGCA
TGGGTCTACAAGGAAGTCTTCACGAGGAGCAGTGAGAACCCAGCGTCGTAGACGGTCTAAGTCTCCTGTTCTTCATCCTC
CCAAATTCATACATTGCAGTACAACAGCACCTCCTTCCAGCAGCCAGCTTAAGCACAGAAGCCAGACTGAGCCACCCGAT
GGCATCAGTGGACGGGGAATTTCAACACCCAAAGAGTTCAACGCAGGAGAAAACTCTACTTCTCTTGATGTTAATCACAC
AGGAGCA
Sequence Type mRNA
Unitrap ID UNI26191

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 163232582..163241393 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035399 (RP23-117O11.3) NM_025699 Uncharacterized protein C20orf111 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q9D722]

 
Come back to gene ENSMUSG00000035399


For any suggestions or comments, please send an email to unitrap@crg.es