Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST131657
Clone ID OST131657
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST131657
Sequence
GAATGATTTCAGAAAACGTGCCTGTTTTCTTAGAATGTCAATGCAGCAAGCAGGTCTGAAGGACTCCTTTCACCGAAGAG
CGTCTTGTCTGCAGTAACTTCACAGACCTGCCTGAGAGGCTCTTCCCAAACTCCACTGCACCCTACCTGCTGCTCCAGAC
TGGAAGCTGCTTAGGCCTTTTCTCATGTGGATCTAAGGGGAATGCTTTACTATGGCTGCTGTTGTCCAACAGAACGACCT
AGTGTTTGAATTTGCAAGTAACGGCATGGAGGACGAGCAGCAGGTGAGCCAGAAAGGCCAGCTTTAGTCCACTTCTTAGG
AGTTGTCATCCGCGTCGGGGTGTTTGCTTNAGGACATAGGACAACATTTTAA
Sequence Type mRNA
Unitrap ID UNI16767

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 79935947..79936318 366
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036461 (Elf1) NM_007920 E74-like factor 1 Gene [Source:MGI Symbol;Acc:MGI:107180]

 
Come back to gene ENSMUSG00000036461


For any suggestions or comments, please send an email to unitrap@crg.es