Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST131478
Clone ID OST131478
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST131478
Sequence
ACTATTCAGATTCCAAAGTCTGACCAATCATTGCACCAGTCGAGCTGACAACCAGTGCTGGCTGTTTGCCTGTACCAACT
ATTAAAAAATAATTCAGTTTAAAA
Sequence Type mRNA
Unitrap ID UNI26102

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 145164064..145164167 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040370 (Lyrm5) NM_133688 LYR motif containing 5 Gene [Source:MGI (curated);Acc:Lyrm5-002]

 
Come back to gene ENSMUSG00000040370


For any suggestions or comments, please send an email to unitrap@crg.es