Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST131428
Clone ID OST131428
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST131428
Sequence
TTGCGGAACTCTCAAAGGNGCGCACAGGAAGNCTGGGCGGCATGNTAAGNCCATCNTCATCTGCCAGGCCTCCTTCCAGC
AGATGCAGCCCAGCCCGCTGCAGCACCAGTTCTCCATGCCCTCCGTGCCCCCGCCAGAAGACCTGCTGGATCACGAGGCC
CTCATTGACCAGTACTTAAGGGACCCTAACCTTCACAAGAAGTATCGAGTGGGGCTGAACCGAGTTGCTGCCCAGGAGGT
ACCTATTGAGATCAAGGTGGTGAACCCACCCACCCTGACCCAGCTGCAGGCACTGGAGCCCAAACAGATGTTCTGGGTGC
GTGCCCGGGGCTACATTGGGGAAGGTGACATCAAGATGCATTGCTGGG
Sequence Type mRNA
Unitrap ID UNI26194

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164620652..164625381 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017307 (Acot8) NM_133240 acyl-CoA thioesterase 8 Gene [Source:MGI (curated);Acc:Acot8-002]

 
Come back to gene ENSMUSG00000017307


For any suggestions or comments, please send an email to unitrap@crg.es