Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST131174
Clone ID OST131174
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST131174
Sequence
ACTGAGCTCCTGTACTCCTCTGTGGAGACATCCAGCGTGTGGCTGCGGGAGTGCTCTGCGAGCTGGCCCAGGACAAGGAG
GCTGCCGACGCCATTGATGCGGAGGGCGCCTCTGCCCCTCTCATGGAGCTACTCCATTCCCGCAATGAGGGCACCGCGAC
CTACGCTGCTGCTGTCCTGTTCCGCATCTCTGAGGACAAGAACCCAGATTACCGTAAGCGAGTGTCTGTGGAGCTCACCA
ATTCCCTCTTCAAGCATGACCCAGCTGCCTGGGAGGCTGCCCAGAGTATGATCCCGATCAACGAACCCTATGCAGACGAC
ATGGATGCCACCTACCGCCCCATGTACTCCAGCGATGTGCCTCTGGACCCTCTGGACATGCACATGGACCTGGATGGAGA
CTACCCCATGGACACCTACAGTGACGGCCTGAGGCCTCCCTACCCCACTTGCAGACCACATGCTTGGCCTAGCCAGCTCC
ACCTNAGCGCTGTTTCTCACCTGGA
Sequence Type mRNA
Unitrap ID UNI2261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100232745..100235792 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]

 
Come back to gene ENSMUSG00000001552


For any suggestions or comments, please send an email to unitrap@crg.es