Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR354
Clone ID RRR354
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR354
Sequence
AGGTGACCAAGCAGATAACACAGGAGGATGACGACAGTGACGAGGAAGTTGCTCCTGAGAACTTTTTCTCCCTCCCTGAC
AAGGCTGAGCCACCTGGAGTTGAGCCATACCCTTACCCTGTCCCCACTGTCCCTGAAGAGCTGCCTCCAGGCACAGAACC
AGAACCAGCTTTCCAGGACGATGCAGCCAATGCCCCCCTTGAGTTTAAGATGGCGGCAGGGTCAAGTGGAGCTCCCTGGA
TGCCGAAGCCTGGGGATGACTACAGCTACAATCAGTTTTCCACATATGGCGATGCCAATGCTGCTGGTGCTTATTATCAG
GATTACTACAGTGGTGGCTACTATCCTGCACCGGACCCGGCTCTGGTCCCTCCCCAGGAAATTGCCCCTGATGCCTCCTT
CATTGATGATGAAGCA
Sequence Type mRNA
Unitrap ID UNI7577

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87671237..87673824 321
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004895 (Prcc) NM_033573 papillary renal cell carcinoma (translocation-associated) Gene [Source:MGI Symbol;Acc:MGI:2137738]

 
Come back to gene ENSMUSG00000004895


For any suggestions or comments, please send an email to unitrap@crg.es