Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR356
Clone ID RRR356
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR356
Sequence
GAATATTCTGCCAGTCATCTGTGCGAAGTGTGAGGTCAACCCAGAACACGTGATTCTGCTCAGAGACAATGTTGCCGGGG
AGGAGCTGGAGCTGTCCAAGTCCCTGAATGAACTAGGGATCAAGGAGCTGTATGCGTGGGACAACAGAAGAGAAATGTTT
AGAAAATCATCACTTGGCAATGATGAGACAGACAAAGAGAAGAAAAAGTTTCTGGGATTTTTCAAAGCTAATAAAAGGAG
CAACAGTAAGGCTGAGCATCTTGGGCTGTCAGGTGCAGATAGTGATGAGGACCCGGCGAAGTCAGCATCTGGAGGGGACT
TGAAC
Sequence Type mRNA
Unitrap ID UNI7131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 12265108..12275964 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020173 (Cobl) NM_172496 cordon-bleu Gene [Source:MGI (curated);Acc:Cobl-003]

 
Come back to gene ENSMUSG00000020173


For any suggestions or comments, please send an email to unitrap@crg.es