Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST131067
Clone ID OST131067
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST131067
Sequence
GACTGAGAGATGACTGAATCCTTTTGTGTTGGAGGAGGCCGTCGGCTTCAAGGATCCAGCAAAAGTGGACCTGGAAAGGG
AGGCAGCCGGAAGGAGGCCCAACTTNCCTTGTTGCAGTGACCCACCAAAGCTAGGGATGCCAGNGGTCCACANGGGACNN
ACNGTGNCTAGCCAGGCCCNCACTNTNCTTTGACCNTGAGANCTCAGCCAGTGACANGACNGAAGGGATGAANANNGGGN
GGCCTANAGCCGAGAACCAAGCTCTGCNAGATATTNCTGTGTGNCNGATGAACCNTAGANAAGANGATTTCACCGCTCTC
TCAATGGTGAACAGTGCATGCTC
Sequence Type mRNA
Unitrap ID UNI26197

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181325172..181325692 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000823 (Znf512b) zinc finger protein 512B Gene [Source:MGI (curated);Acc:Znf512b-001]

 
Come back to gene ENSMUSG00000000823


For any suggestions or comments, please send an email to unitrap@crg.es