Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST130840
Clone ID OST130840
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST130840
Sequence
TCGGGATGTTTGACGGCTATGATAGCTGCAGTGAGGACACAAGTAGCAGCTCCAGCTCTGAGGAGAGTGAAGAAGAAGTT
GCTCCTTTACCTTCCAATCTCCCAATCATCAAGAATAATGGACAAGTCTACACATACCCAGATGGTAAATCTGGCATGGC
TACCTGTGAGATGTGTGGGATGGTCG
Sequence Type mRNA
Unitrap ID UNI22898

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 93766514..93770144 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059474 (Mbtd1) NP_598773 mbt domain containing 1 Gene [Source:MGI (curated);Acc:Mbtd1-009]

 
Come back to gene ENSMUSG00000059474


For any suggestions or comments, please send an email to unitrap@crg.es