Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR398
Clone ID RRR398
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR398
Sequence
TCTTAAATAGCTATACAAAAGGAGTGAAAAGCCAAGAGAACGAAGTCTTTCTTTCTCTTTCTTGCGGGAGAACTTAATGC
TGCATTTATCATTAACCTAGCACCCTAACATAAAACAAAAGGAAGAAAAGGATTAAGGAAGGAAAAGGTGATTCAAGAAG
AGCCATCATGTCGGGGCGACCGAGAACCACCTCCTTTGCGGAGAGCTGCAAGCCAGTGCAGCAGCCTTCAGCTTTTGGTA
GCATGAAAGTTAGCAGAGATAAAGATGGCAGCAAGGTAACCACAGTAGTGGCAACTCCTGGCCAGGGTCCTGACAGGCCA
CAGGAAGTCAGTTATACAGACACGAAAGTGATTGGAAATGGATCATTTGGTGTGGTATATCAAGCCAAACTTTGTGATTC
TGGAGAATTGGTTGCCATCAAGAAAGTTATACAGGACAAGGGATTTA
Sequence Type mRNA
Unitrap ID UNI7587

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38090445..38144537 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022812 (Gsk3b) NM_019827 glycogen synthase kinase 3 beta Gene [Source:MGI (curated);Acc:Gsk3b-001]

 
Come back to gene ENSMUSG00000022812


For any suggestions or comments, please send an email to unitrap@crg.es