Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR431
Clone ID RRR431
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR431
Sequence
GGTCAAGCTTGCAAGCTCCTTTCTGTAACTCAGCAGTCATGAGAGTTTCTGTGTGATGTGTTCTGCGTGACTCTACTGGG
TGTTGTGAGAGGAGGTTAGTCAAGCTCAGAACTCCAAACATGTGTCTTCGCTGGATGCTGTGAATTTAGCTCAAGCAAGC
TCAGAACTTCACACAT
Sequence Type mRNA
Unitrap ID UNI7596

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175100583..175544915 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078893 (BX890623.7-202) Novel KRAB box and zinc finger, C2H2 type domain containing protein [Source:UniProtKB/TrEMBL;Acc:A2ARL5]

 
Come back to gene ENSMUSG00000078893


For any suggestions or comments, please send an email to unitrap@crg.es