Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR440
Clone ID RRR440
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR440
Sequence
CGGACGGGGTTGCCATGGCCCCCGGCTGCAAATCTGAGTTACGGAATGTGACAAAATTCTCATTCTAACCAGCCAAGTAA
TGAAGGTGACGCTATCAAAGTTTTTGTGCGAATTCGTCCTGCTGAAGAGGGCGCCAGATCAGCGGATGGAGAGCAGAGCT
TTTGCTTATCTGTGCTCTCCCAGACCACTCTCCGGCTACACTCCAACCCAGACCCCAAGACTTTTGTATTTGATTATGTT
GCAGGCATGGACACCACTCAGGAGTCTGTATTCTCAACAGTGGCTAAAAGCATTGTGGAATCATGCATGAGCGGTTATAA
TGGGACCATCTTTGCATATGGGCAGACTGGCTCTGGGAAGACATTTACTATGATGGGACCATCAGACTCTGATAATTTTT
CTCATAATCTGAGAGGAATAATTCCACGAAGTTTTGAATATTTGTTTTCCTTAATTGATCGTGAAAAAGAAAAGGCTGGA
GCTGGGAAGAGTTTCCTTTGTAAGTGCTCCTTTATTGAGGTCTACAATGAGCAGATATATGACCTCCTGGACTCGGCGTC
AGTCGGACTGTATTTGAGAGAGCACATAAAGAAGGGAGTCTTTGTGGTCGGTGCAGTGGAGCAGGCGGTGACCTCAGTTG
CCGAGACCT
Sequence Type mRNA
Unitrap ID UNI7599

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 122868235..122884941 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036768 (Kif15) NM_010620 kinesin family member 15 Gene [Source:MGI Symbol;Acc:MGI:1098258]

 
Come back to gene ENSMUSG00000036768


For any suggestions or comments, please send an email to unitrap@crg.es