Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR445
Clone ID RRR445
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR445
Sequence
GCAACCATCCTTTTTGCAAATCCTTGCAGTGGCAGGCCAACATCCTCCTGGGCGCCTGCAACCTTGACTGTTTCCACTCA
GACAAGCATGAGGACGTCATTGCTCGTGAATTGATAGAGAAAATGATTGCTATGGATCCCCAGCAGCGTCCCTCTGCAAA
GCACGTGCTGAAACACCCCTTCTTCTGGAGCCTGGAGAAGCAGCTCCAGTTTTTCCAGGATGTAAGTGACCGAATAGAAA
AGGAGGCCTTGGACGGTCCAATCGTACGGCAGTTGGAGAGAGGCGGGAGAGCTGTGGTCAAGATGGACTGGCGGGAGAAC
ATCACTGTCCCCCTGCAGACAGATCTGCGCAAATTCAGAACCTACAAAGGTGGCTCTGTGAGAGACCTCCTCCGAGCCAT
GAGAAACA
Sequence Type mRNA
Unitrap ID UNI7601

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106261088..106267125 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020715 (Ern1) NM_023913 endoplasmic reticulum (ER) to nucleus signalling 1 Gene [Source:MGI (curated);Acc:Ern1-001]

 
Come back to gene ENSMUSG00000020715


For any suggestions or comments, please send an email to unitrap@crg.es