Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST130090
Clone ID OST130090
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST130090
Sequence
GACTGAGGTTGAAAGGAAATGTCCTTATTTAAAGCCCGTGACTGGTGGTCTACTGTGTTGGGAGAAAAAGAAGAATTTGA
CCAGGGCTGCTTATGCTTGGCTGATGTGGACAACAGTGGGAACGGCCACGATAAAATCATTGTGGGCAGCTTCATGGGCT
ACCTGAGAATCTTTAGTCCCCATTCTGTAAAAGCTGGAGGTGGGCCTCAGGCTGAAGATTTACTTCTAGAAGTGCATCTG
CGGGACCCAGTGCTGCAAGTGGAAGTCGGGAAGTTTGTCTCGGGCACCGAGATGCTTCATCTGGCCGTGCTGCACTCCCG
GAAGCTCTGTGTCTACTCCGTCTCAGGGACATTGGGAAATGTGGAACATGGGAAACCAATATCAGATAAAACTAATGTAT
GAGCACCATCTTCAGAGGACGGCCTGCAATATGACCGTATGGACCCTTTGGTGGTGTAAAAGGTAACTTGCTNTGAGTTA
TACACATGGGTATTTCAAGTG
Sequence Type mRNA
Unitrap ID UNI17230

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22295260..22318575 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035919 (Bbs9) NM_181316 Bardet-Biedl syndrome 9 (human) Gene [Source:MGI Symbol;Acc:MGI:2442833]

 
Come back to gene ENSMUSG00000035919


For any suggestions or comments, please send an email to unitrap@crg.es