Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR472
Clone ID RRR472
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR472
Sequence
AAAGCATTTATGAATAATAAGTTTGGACTACAAAGAATTCTAGGAGATGAGAGAAGCCTTTTACTGTTGGCAAGAGCAAT
TGACCCGAAACAACAGAATATGATGACTGAAATAGTAAAAATCCTTTCTGCTATTTGCATTGTTGGGGAAGAAAACATTC
TAGACAAACTTTTAGGGGGCATCACTGCTGCAGCTGAACTAAATAATAGAGAACGATTTTCACCAATTGTGGAAGGCTTA
GAAAATAATGAAGCCTTGCATCT
Sequence Type mRNA
Unitrap ID UNI7607

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 126473988..126478483 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034480 (Diap2) NM_017398 diaphanous homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Diap2-001]

 
Come back to gene ENSMUSG00000034480


For any suggestions or comments, please send an email to unitrap@crg.es