Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR478
Clone ID RRR478
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR478
Sequence
AGCTCTAGAAATAGATGTTGAAGAACAAGTCAGTAGGTTCATAGAACTGGAGCAAGAGAAAAACGCTGAACTCACAGATC
TAAGGCAGCAAAGCCAAGCGCTGGAGAAGCAGCTGGAAAAAATGAGAAAATTTTTAGATGAGCAGGCCATCGATAGAGAG
CATGAGAGAGATGTTTTTCAGCAGGAGATACAGAAGCTGGAGCATCAGCTTAAGGCTGCGCCTAGAATCCAGCCTGTGAG
TGAGCACCAAGCCAGAG
Sequence Type mRNA
Unitrap ID UNI7611

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 4032775..4034865 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]

 
Come back to gene ENSMUSG00000040407


For any suggestions or comments, please send an email to unitrap@crg.es