Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR480
Clone ID RRR480
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR480
Sequence
AAGATCAAAGAGAAGTACATTGACCAGGAGGAGCTGAACAAGACAAAGCCTATTCTGGACCAGAAACCCGGATGACATCA
CGCAGGAGGAGTATGGCGAATTCTATAAGAGCCTCACCAATGACTGGGAGGACCACTTGGCAGTCAAGCACTTCTCTGTA
GAAGGTCAGTTGGAATTCAGGGCATTGCTCTTCATTCCCCGGCGGGCTCCCTTCGACCTTTTTGAGAACAAGAAGAAGAA
GAACAACATCAAATTGTATGTCCGCCGTGTGTTCATCATGGACAGCTGTGACGAGCTGATACCTGAGTACCTCAACTTTA
TCCGCGGTGTGGTTGACTCCGAGGACCTGCCCCTGAACATCTCCCGGGAGATGCTGCAGCAGAGCAAGATCCTGAAGGTC
ATCCGCAAGAACATCGTCAAGAAGTGCCTGGAGCTCTTCTCCGAGCTGGCTGAGGACAAGGAGAACTACAAGAAGTTCTA
TGAGGCCTTCTCCAAAAATTTAA
Sequence Type mRNA
Unitrap ID UNI7536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45706421..45707353 357
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023944 (Hsp90ab1) NM_008302 heat shock protein 90kDa alpha (cytosolic), class B member 1 Gene [Source:MGI (curated);Acc:Hsp90ab1-001]

 
Come back to gene ENSMUSG00000023944


For any suggestions or comments, please send an email to unitrap@crg.es