Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST129758
Clone ID OST129758
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST129758
Sequence
GACTGAGTTCCGGTTCCTAGCAAATTTACTAGNCGAGTATCAGGCTGGGNAGNNACGTTANGCCCTGCTGATGAAGAGNT
NGATNACGATCCNAGGGTGGTATCNTGACCCATACTGCATGANCTNAGATGCCGGATNNACCAACTNTGTATANATATTN
ANACNTATATATACTCTAGACACACACCCGCNCTCTCNACANNTNNNTNCCATGTTNGAANTGNNTGTNTNTNNTGCCGA
GCGTGTNATTGACCAAGGCGACGACGGGGNCGNCTTTTATGTCATAGAACGGGGAACCTATGACNTTTTAGTAACGAAAG
ATAATCAAACACGTTCTGTTGGTCAGTATGACAACCGTGGCAGTTTTGGAGAACTAGCTCTGATGTACAATACCCCGAGA
GCTGCTACCATCATCGCCACCTCAGAGGGCTCCCTTTGGGGATTGGACCGGGTGGACTTTTAGAAGAATCATAGNGAAAA
ACANTGCCAAGAAGAGGAAGATGTTTGAATCATTTATTGAG
Sequence Type mRNA
Unitrap ID UNI26226

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108616602..108642840 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032601 (Prkar2a) NM_008924 protein kinase, cAMP dependent regulatory, type II alpha Gene [Source:MGI Symbol;Acc:MGI:108025]

 
Come back to gene ENSMUSG00000032601


For any suggestions or comments, please send an email to unitrap@crg.es