Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CH0516
Clone ID CH0516
Vector pGT0lxr
Project sanger

Sequence tag CH0516
Sequence
CGTTTGTTTTTTGAGACAGGGCTTCTTTGTATAGTCCTGGCTGATATGAAACTCACTTTGCAGACCAGGTCGGCCCATCC
TTTTCTTTATCTAGCCTCCCACCTATTCGACTAATCACATGATCTGCCCCATCCTGTCTCTCCCTCCCCTGGTTTCATCC
GCCTTTATCTCCACATTCCGAGCCAGAGGGGAGCGGGGAGCCGAGCCGCGCGGAGCCGCGGCCGGAGCGCAGTGCGAGCG
CCACCCGAGCCAACCCCACCCGCGCGTCCGTGCGGTCGCGGTCCCTATCCCGGACGCCGTCCGGCCCGAAGCGCTTGACC
TGCCGGCCCGCGGGGTTCCGGGCGCCGGGGAGCCGGGCCAAAGGGTCTTGGCCGCTGCGCTCGGCACCGCGCTTGGCAGA
GTCTAGG
Sequence Type mRNA
Unitrap ID UNI770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65194810..65195032 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029178 (Klf3) NM_008453 Kruppel-like factor 3 (basic) Gene [Source:MGI Symbol;Acc:MGI:1342773]

 
Come back to gene ENSMUSG00000029178


For any suggestions or comments, please send an email to unitrap@crg.es