Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR497
Clone ID RRR497
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR497
Sequence
AGTCGAAGAGCAGCAGCTGGAGGAGTAGGACGTGTCGCCAGGTCAGCCATGTCATTTGAGCCTCCTCCACCGCCGCTGCA
GCCCCCCACGCATCAGACTTCTGTAGGGCTATTGGATACCCCTCGCACCCGGGATCGCTCTCCATCCCCCCTGCGGGGCA
ATGTGGTCCCTAGCCCTCTGCCTACCCGCCGGACAAGGACCTTTTCAGCGACAGTGCGGGCTTCGCAGGGCCCCGTCTAC
AAAGGAGTCTGTAAATGCTTCTGCCGGTCCAAGGGCCACGGTTTCATCACCCCAGCTGATGGTGGTCCTGACATCTTCCT
GCA
Sequence Type mRNA
Unitrap ID UNI1822

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 8663689..8672246 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008393 (Carhsp1) NM_025821 calcium regulated heat stable protein 1 Gene [Source:MGI Symbol;Acc:MGI:1196368]

 
Come back to gene ENSMUSG00000008393


For any suggestions or comments, please send an email to unitrap@crg.es