Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST129580
Clone ID OST129580
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST129580
Sequence
TTGGGACTACATGGTAATCCCATGATATAGCTGACTTTCCCCGACCCGTTCATCACAGGATCCCCAACTTCAAGGGGTCC
TACCTGGCTGGCCAGAGCATCAGAGACCTGGAAGTCTTTGCTGGGACACAGGAAGTGAAAGTGGACCCTGATAAGCCCCT
GGAAGGTGTCCGATTCCTGGCACTGCAGAGCAAAAAAACACTGCTGGTCCCAACACCACGACTGCGAACAGGGCTGTTTA
ACAAGANCACGCCACCCCCTGGAGCCACCAAAGACATTCTGAGGAAATGTGCCACCTCCCANAGCAGGCTGGGAANCAAG
CCTNTGTCATTTGGAACCGNTGACNGGAGCCTGATTGCCTGTCACCAGACACTTTCACAGNCCTGCTAAACTGGNNCTGG
AAACNCACTNGAGGGATGGAGAGCCAGGGTTCGCGTCTTACATACAATAAC
Sequence Type mRNA
Unitrap ID UNI26228

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123627934..123630842 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031816 (Mthfsd) NM_172761 methenyltetrahydrofolate synthetase domain containing Gene [Source:MGI Symbol;Acc:MGI:2679252]

 
Come back to gene ENSMUSG00000031816


For any suggestions or comments, please send an email to unitrap@crg.es