Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST129469
Clone ID OST129469
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST129469
Sequence
CGCAGTGGAAGTAGGTGGTGAGCGAGGTGGTGGGCCACGCCAAGGAGGTTGGAGAGAAGGCCATTAATGACGCCCTAAAG
AAAGCCCAAGAATCAGGAGACAGGGTGGTGAAGGAGGTCACTGAGAAGGTCACCCACACCATCACTGATGCTGTTACCCA
TGCGGCAGAAGGCCTGGGAAGACTGGGACAGTGAGCCTGCCTACCAGCATGGCTGGCCNTTCCTGAAGGTCAATAAAGAG
TGTGAAACGTGAA
Sequence Type mRNA
Unitrap ID UNI12870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35165071..35166942 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043681 (2200001I15Rik) NM_183278 RIKEN cDNA 2200001I15 gene Gene [Source:MGI Symbol;Acc:MGI:1916384]

 
Come back to gene ENSMUSG00000043681


For any suggestions or comments, please send an email to unitrap@crg.es