Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST129230
Clone ID OST129230
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST129230
Sequence
ACTGAGTTGAGTGGTGATTTTATGCAATGGCTTCAAGCCACAGTTCTTCTCCAGTGCCTCAAGGAAGCAGCAGTGATGTT
TTCTTTAAAAAAGAGGTAGATCCAACAAAACACATTCGACCTGTGCAGTCACTGCCAGATGTGTGTCCCAAGGAACCCAC
AGGTGATTCACATACTTTATGTGTTGCCCCATCTCTAGTTACAGATCAACATAGATGGACTGTGTATCATTCCAAAGTAA
ATCTCCCAGCAGCATTAAATGATCCTACACTAGCAAAAAGAGAATCTGACTTCTTCACAAAAACTTGGGGATTGGACTTT
GTGGACACTGAAGTCATACCTTCACTCTACCTCCCACAGATCAGCAAGGAGAATTTTATAGCATATCAGCAGGAGATCTC
TCAGAGAGAGAAGATTCATGAGAGATGCAAGAATATTNGTCCTCCTAAAGATACCTTTGACAGGACTCTTTTACATATTC
ATGATAAATCCAGGACAGATCTGGAGCAAGTACCTAAGATTTTTATGAAACCCAGATT
Sequence Type mRNA
Unitrap ID UNI18165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21163200..21171741 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]

 
Come back to gene ENSMUSG00000020128


For any suggestions or comments, please send an email to unitrap@crg.es