Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST129085
Clone ID OST129085
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST129085
Sequence
GACTGAGGACTTGCTGTGACCTCCGGGACATCTCTGCACACCCCACAACCGCGGCCTCAACAACAAATGTTTCGACGACT
GCATGTGCATGGAAGGGCTGCGTTGCTATGCCAAATTCCACCGGAACCGCAGGGTCACTCGGAGGAAGGGGCGCTGCGTG
GAACCAGAGACAGCCAACGGGGACCAGGGATCTTTCATCAACATCTAGTGCCCTAGTGGTGCCTCCCCACTGGCCCGGGA
TCTGAGCCAGGGAGGTTTAGGACAAACAGGACCGTGTTAGTAACTAGCTCAGCTTGGGCTGAGTAGGGAACCAATGGCTG
AGGCAGCAGGTGTACGCCCAGTACACTCAACCACAAGCTGGAGAGCGGTTTAGCAGAGAGCAGTGCGCCAGAGCCCTCCC
GCCCGCAGTCCGGGGTGGGACCCCCACCTGCTNCCCTGATTCTGCTCGATTNGGCGGNGGCTTTGTGGAGCGCACCCTCT
TCTGCTCGACACCAGCATTGCAGCAGTT
Sequence Type mRNA
Unitrap ID UNI14670

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147476280..147482131 395
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029005 (2610109H07Rik) NM_027426 RIKEN cDNA 2610109H07 gene Gene [Source:MGI Symbol;Acc:MGI:1917683]

 
Come back to gene ENSMUSG00000029005


For any suggestions or comments, please send an email to unitrap@crg.es