Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST128985
Clone ID OST128985
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST128985
Sequence
AAAGATGATGTCTGCAAACACCGTGGCTAAAGTGATGATCATNATGCTGGCAGNCTGTCTTCTTACCCAAACGGATGGGA
AACCCGTGAGGAAGAGAGCTGTCAGTGAAATACAGCTTATGCACAACCTGGGCAAACACCTGGCCTCCATGGAGAGGATG
CAATGGCTGAGAAGGAAGCTGCAAGATATGCACAATTTTGTTAGTCTTGGAGTCCAAATGGNTGCCAGAGATGGCAGTCA
CCAGAAGCCCACCAAGAAGGAGGAAAATGTCCTTGTTGATGGCAATCCAAAAAGTCTTGGTGAGGGAGACAAAGCTGATG
TGGATGTATTAGTTAAATCAAAATCTCAGAAATGCTGATTTATTCTAGACAGTGCAGGGCACTGACNTATGCTGCTACCT
TTTCAAGCTTATGAAGATCACCAAGTGCTAATACTTCTACTGNAATGAAACTTTGGAATTTTTTTGATTACNTTTTTGCT
CATTTAAGGTCTCTTTCAATGAT
Sequence Type mRNA
Unitrap ID UNI26240

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 120529179..120529798 404
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059077 (Pth) NM_020623 parathyroid hormone Gene [Source:MGI Symbol;Acc:MGI:97799]

 
Come back to gene ENSMUSG00000059077


For any suggestions or comments, please send an email to unitrap@crg.es