Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST128558
Clone ID OST128558
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST128558
Sequence
GTGGCGACGCCTGGACTCCGTCCAGAGACACCTGTACCAGGACGTGATGCTGGAGATCTACAGCCACCTCTTGGCAGTGG
GCTACCCTGTTCCTAGCCCTGGGGCCATCTTCAGGATAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI26248

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 50822685..50823059 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056592 (BC043301) NM_001008549 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3U2V8]

 
Come back to gene ENSMUSG00000056592


For any suggestions or comments, please send an email to unitrap@crg.es