Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST128398
Clone ID OST128398
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST128398
Sequence
TTTCTGAGGTCCTAATGAGCCCTTTTNAGGAGCGNCTCAAGTGGAAGAGTGACTATCCCATGACTGATNTTCAGCTGCGG
AGCAAACGAGATGAGTTCTGGGACACAGCACCTGCCTTTGAGGGCCGCAAGGAGATCTGGGATGCCCTCAAGGCTGCTGC
CTATGCTGCTGAAGCTAATGACCATGAGCTGGCTCAGGCCATCCTGGATGGAGCCAGCATCACCCTGTTTTATGGAACTC
TTTGTGAATGCTATGACGAGCTGGGTAACCGCTATCAACTGCCCATCTATTGCCTGTCCCCACCTGTGAACTTGCTGCTG
GAGCACACGGAGGAGGAGAGCCTGGAGCCTCCCGAGCCCACCCCTAGTGTGCGCCGTGAATTCCCACTGAAAGTGCGCCT
CTNCACAGGCAAGGACNTGAGGCTCAATGCCAGCCTGCCTGACACGGTGGGGCAACTCAAGAGGCAAGCTTGCNCAGCCA
GGAGGGCATTGAGCCATCCTGGCAGAGA
Sequence Type mRNA
Unitrap ID UNI23282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 42106377..42108350 261
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025171 (Ubtd1) NM_145500 ubiquitin domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2385092]

 
Come back to gene ENSMUSG00000025171


For any suggestions or comments, please send an email to unitrap@crg.es