Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR676
Clone ID RRR676
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR676
Sequence
AAGTTGGTGACCGTTGTTATGATGAAAAAATGTATGATGCTGCTAAGTTGTTGTACAATAATGTTTCTAACTTTGGACGC
TTGGCATCTACCCTTGTTCACCTTGGCGAGTATCAGGCAGCAGTTGATGGTGCCAGAAAAGCTAATAGTACTCGAACATG
GAAAGAGGTCTGCTTTGCCTGTGTAGATGGGAAAGAGTTCCGCCTTGCTCAGATGTGTGGACTCCATATTGTGGTGCATG
CAGATGAATTAGAGGAGCTTATCAACTACTATCAGGATCGTGGATATTTTGAAGAACTCATCACCATGTTGGAGGCAGCC
TTGGGACTGGAGCGAGCTCACATGGGAATGTTCACAGAGCTAGCTATTTTGTATTCTAAATTCAAGCCACAGAAAATGAG
AGAACACCTGGAGTTGTTCTGGTCGAGAGTGAATATTCCTA
Sequence Type mRNA
Unitrap ID UNI7641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86518144..86518812 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047126 (Cltc) NM_001003908 clathrin, heavy polypeptide (Hc) Gene [Source:MGI (curated);Acc:Cltc-001]

 
Come back to gene ENSMUSG00000047126


For any suggestions or comments, please send an email to unitrap@crg.es