Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR695
Clone ID RRR695
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR695
Sequence
GGCGGCGGCGGCTCTGGGGGCTGGGGAGCGGGCGGCTTGATCGGGTTCATGAAGGACGCCTTCCAGCCGCACCACCACCA
CCACCACCACCTCAGCCCGCACCCTCCCTGCACGGTGGACAAGAAGATGGTGGAGAAGTGCTGGAAGCTCATGGACA
Sequence Type mRNA
Unitrap ID UNI2131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44041785..44041938 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034342 (Cbl) NM_007619 Casitas B-lineage lymphoma Gene [Source:MGI Symbol;Acc:MGI:88279]

 
Come back to gene ENSMUSG00000034342


For any suggestions or comments, please send an email to unitrap@crg.es